| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.178044 |
| Chromosome: | chromosome 12 |
| Location: | 9143981 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g542500 | STM6,MOC1 | Mitochondrial transcription termination factor; (1 of 10) PF02536 - mTERF (mTERF) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTATTATAAGCATGAGCGCGTGAGACAGA |
| Internal bar code: | GTGCGGTTGCGGGGGCAAAATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 646 |
| LEAP-Seq percent confirming: | 99.4224 |
| LEAP-Seq n confirming: | 1205 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGTTGTACACAGCAGCACT |
| Suggested primer 2: | GTCCGTGCATGGTCCTAACT |