| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.178051 |
| Chromosome: | chromosome 12 |
| Location: | 5460994 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g530600 | GLN3 | Glutamine synthetase; (1 of 2) PTHR20852:SF57 - GLUTAMINE SYNTHETASE 2 CYTOPLASMIC | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGCCTTCGTTGCCATCCGCCCAGATGTAC |
| Internal bar code: | GGTACCACTCGGGGCGATGGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 856 |
| LEAP-Seq percent confirming: | 99.7976 |
| LEAP-Seq n confirming: | 986 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGTACTCCTGCTCGAAGCC |
| Suggested primer 2: | ACACCCAGGTCAGCCACTAC |