Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.178083 |
Chromosome: | chromosome 14 |
Location: | 2463001 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g624950 | DYH1B,IA1-DHC1beta,DHC10,IDA2 | Flagellar Inner Arm Dynein I1/f Heavy Chain beta; (1 of 1) PTHR10676//PTHR10676:SF183 - DYNEIN HEAVY CHAIN FAMILY PROTEIN // DYNEIN HEAVY CHAIN 2, AXONEMAL | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTCAACCTGGCATCCACCCTCGCATAATA |
Internal bar code: | CGGAAGCTGAGGGGGCTCACGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 713 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 1072 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAGGTCGTGTGAGAAATGGG |
Suggested primer 2: | CGCAAAAGAAGGAGAAGTGG |