| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.178083 |
| Chromosome: | chromosome 14 |
| Location: | 2463001 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g624950 | DYH1B,IA1-DHC1beta,DHC10,IDA2 | Flagellar Inner Arm Dynein I1/f Heavy Chain beta; (1 of 1) PTHR10676//PTHR10676:SF183 - DYNEIN HEAVY CHAIN FAMILY PROTEIN // DYNEIN HEAVY CHAIN 2, AXONEMAL | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTCAACCTGGCATCCACCCTCGCATAATA |
| Internal bar code: | CGGAAGCTGAGGGGGCTCACGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 713 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 1072 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGGTCGTGTGAGAAATGGG |
| Suggested primer 2: | CGCAAAAGAAGGAGAAGTGG |