| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.178111 |
| Chromosome: | chromosome 7 |
| Location: | 1800347 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g325724 | PTP1 | Protein tyrosine phosphatase 1; (1 of 1) K18078 - protein tyrosine phosphatase domain-containing protein 1 [EC:3.1.3.-] (PTPDC1) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCGTCAAGGCTATGTTGGCCCCAACCCTT |
| Internal bar code: | CAACTTATTAGGTTGGCCTTTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 22 |
| LEAP-Seq percent confirming: | 99.2806 |
| LEAP-Seq n confirming: | 138 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTAGCAGCTCACCCATCGT |
| Suggested primer 2: | CTGCTGTATGTCCTGGCTCA |