| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.178224 |
| Chromosome: | chromosome 3 |
| Location: | 7746472 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g203451 | CYA5 | Adenylate cyclase; (1 of 70) 4.6.1.1 - Adenylate cyclase / ATP pyrophosphate-lyase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGTCATTCGCCCCGGAGCGCCCTCCACTC |
| Internal bar code: | TGAAGGAGGTCCGCTAGCCAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 588 |
| LEAP-Seq percent confirming: | 90.2831 |
| LEAP-Seq n confirming: | 2137 |
| LEAP-Seq n nonconfirming: | 230 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAAGGGTTGGCTTTGATGT |
| Suggested primer 2: | GGAGTTGGGTTTTGGGTTTT |