| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.178356 |
| Chromosome: | chromosome 6 |
| Location: | 5012216 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g280150 | PSBP9 | PsbP-like protein of thylakoid lumen; (1 of 3) PTHR31407//PTHR31407:SF18 - FAMILY NOT NAMED // PSBP DOMAIN-CONTAINING PROTEIN 4, CHLOROPLASTIC | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCTGTACACCTTTGCCACTGCCTATCACC |
| Internal bar code: | GGTGGACGTCACACGCTAAATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 195 |
| LEAP-Seq percent confirming: | 83.8071 |
| LEAP-Seq n confirming: | 3007 |
| LEAP-Seq n nonconfirming: | 581 |
| LEAP-Seq n unique pos: | 49 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGGTCCATGATATCCCAAA |
| Suggested primer 2: | CTCTGCCCTCAGGCAACTAC |