Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.178369 |
Chromosome: | chromosome 13 |
Location: | 3794996 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g589870 | (1 of 20) 3.1.4.17 - 3',5'-cyclic-nucleotide phosphodiesterase / Cyclic AMP phosphodiesterase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAGTTAGACGATGCGCCCCCTCATCATCC |
Internal bar code: | CGCGCTGTGGCATCTCCTCAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 604 |
LEAP-Seq percent confirming: | 49.0909 |
LEAP-Seq n confirming: | 54 |
LEAP-Seq n nonconfirming: | 56 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGCAGCTCCAAACGTATCA |
Suggested primer 2: | CTATATGGGGGAGCGAGTCA |