Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.178370 |
Chromosome: | chromosome 17 |
Location: | 563665 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g699750 | CTL2 | (1 of 1) IPR016187//IPR024616 - C-type lectin fold // Pherophorin; Putative pherophorin with C-type lectin | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTCAACTACAGTGCCCTCCACGGGTGCAA |
Internal bar code: | GTAGGGCGTTGGTGCAGGTGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 784 |
LEAP-Seq percent confirming: | 49.5225 |
LEAP-Seq n confirming: | 363 |
LEAP-Seq n nonconfirming: | 370 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGTGAAGGAGGAGGAGGAGC |
Suggested primer 2: | CGAGCCTGAAGACCTGATTC |