| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.178413 |
| Chromosome: | chromosome 6 |
| Location: | 8859859 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g310750 | COPG1 | (1 of 1) K17267 - coatomer protein complex, subunit gamma (COPG); Gamma subunit of COP-I complex | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCACCTGCGGCCTTCGAGCATCGAATCGCT |
| Internal bar code: | AGGGCAACGAGGCGTAAGCCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 878 |
| LEAP-Seq percent confirming: | 99.5565 |
| LEAP-Seq n confirming: | 898 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACAAGCCAGCAACTTGTGC |
| Suggested primer 2: | CTTGTCCTTGCTTGCTCTCC |