Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.178496 |
Chromosome: | chromosome 7 |
Location: | 3314515 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g334650 | (1 of 1) K10695 - E3 ubiquitin-protein ligase RNF1/2 [EC:6.3.2.19] (RNF1_2) | CDS/intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTGCAGGTAGACACGCGTGTTGTGCAGTA |
Internal bar code: | CTGAACTCCCTCCAGGGTTCCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 748 |
LEAP-Seq percent confirming: | 18.2203 |
LEAP-Seq n confirming: | 43 |
LEAP-Seq n nonconfirming: | 193 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGGTTGCTGGGTGTTTTCTA |
Suggested primer 2: | GCGAGGTAGGCTGTCGTAAG |