| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.178539 |
| Chromosome: | chromosome 2 |
| Location: | 1515660 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g084300 | COQ5,UMM2,COQ5C,MENG | (1 of 1) K03183 - demethylmenaquinone methyltransferase / 2-methoxy-6-polyprenyl-1,4-benzoquinol methylase (ubiE); Phylloquinone biosynthesis methyltransferase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAAGCAACGTGTTGCCGTGGCTCACTGACG |
| Internal bar code: | ACAACGGCCCTCTACGGAGGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 988 |
| LEAP-Seq percent confirming: | 99.7633 |
| LEAP-Seq n confirming: | 843 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGCACGTAATGCGTGTGTT |
| Suggested primer 2: | CTGTTCCGGAGCTAGGTGTC |