Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.178568 |
Chromosome: | chromosome 14 |
Location: | 2281368 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g623300 | NCP1,NCPR1,NCR1 | NADPH--cytochrome P450 reductase-related protein; (1 of 1) 4.1.3.44 - tRNA 4-demethylwyosine synthase (AdoMet-dependent) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCTACGTCCACTCAGTTGTGTGCATCTGC |
Internal bar code: | CTTGTGTCTAATCTTGGATTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 47 |
LEAP-Seq percent confirming: | 99.4413 |
LEAP-Seq n confirming: | 178 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTCTGGACTGCTCCTTCCAC |
Suggested primer 2: | GAGATAGGGGGAAGCCACTC |