| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.178609 |
| Chromosome: | chromosome 11 |
| Location: | 3172427 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g479350 | (1 of 3) PTHR31563//PTHR31563:SF1 - FAMILY NOT NAMED // ION CHANNEL POLLUX-RELATED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCATACCCCCTCTCGCGCCCTGCAATGCCT |
| Internal bar code: | TGACCCCATGGTACGTAGGGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 616 |
| LEAP-Seq percent confirming: | 97.6546 |
| LEAP-Seq n confirming: | 1832 |
| LEAP-Seq n nonconfirming: | 44 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACATGCATTGCACCCTGTT |
| Suggested primer 2: | TCTTCCTTGCAGACGACCTT |