| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.178624 |
| Chromosome: | chromosome 12 |
| Location: | 3617853 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g514000 | LAG1 | Predicted protein related to longevity assurance protein; (1 of 5) 2.3.1.24 - Sphingosine N-acyltransferase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCATATCAGCTGCAGAATGTACACGAAAAT |
| Internal bar code: | AGTTCCGCCCAGAGCTTGAGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 763 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 194 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCCCAGTGAACGAAATGAG |
| Suggested primer 2: | CCGCTGCTTAGTAGGTCAGG |