| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.178647 |
| Chromosome: | chromosome 3 |
| Location: | 5483730 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g185500 | VIP1,FAP160 | Diphosphoinositol Pentakisphosphate Kinase; (1 of 2) 2.7.4.21//2.7.4.24 - Inositol-hexakisphosphate kinase / IP6K // Diphosphoinositol-pentakisphosphate kinase / PP-IP(5) kinase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGGGGCGGGGGGGCAAGGGGGCCGGGCCG |
| Internal bar code: | GGGAATACTGTAGTGTGAGTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 947 |
| LEAP-Seq percent confirming: | 99.6584 |
| LEAP-Seq n confirming: | 4668 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACTCACATGGACAACCCAG |
| Suggested primer 2: | GGCGAGTTGATATCTGAGGC |