| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.178648 |
| Chromosome: | chromosome 1 |
| Location: | 2289245 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g012500 | PRA1 | (1 of 2) PF03208 - PRA1 family protein (PRA1); Similar to Prenylated Rab Acceptor Protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACGTGCATTATGCATAGGGCATTCCCTCC |
| Internal bar code: | GGTTTGGGCGAAGTCACCCGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1009 |
| LEAP-Seq percent confirming: | 99.9138 |
| LEAP-Seq n confirming: | 1159 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTACGAGTCCAAGGAGCAGC |
| Suggested primer 2: | GCCAACGCGGTATGATACTT |