| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.178786 |
| Chromosome: | chromosome 7 |
| Location: | 4802281 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g345700 | COQ10 | Coenzyme Q-binding protein; (1 of 1) K18588 - coenzyme Q-binding protein COQ10 (COQ10) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCCTCACCTTACCACAGCTTCTTCCTCCC |
| Internal bar code: | TACACCACATGCATGCGAGGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 179 |
| LEAP-Seq percent confirming: | 90.4621 |
| LEAP-Seq n confirming: | 1527 |
| LEAP-Seq n nonconfirming: | 161 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCGACTGTAGAGCATCCACG |
| Suggested primer 2: | CTCCCCTTCCCTTGGTTTAG |