| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.178819 |
| Chromosome: | chromosome 13 |
| Location: | 1691501 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g574200 | PAP2 | (1 of 3) K03514 - non-canonical poly(A) RNA polymerase PAPD5/7 (PAPD5_7, TRF4); Class-II RNA nucleotidyl transferase 2 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGATGCAACAACGCCAGACACCACATAGCG |
| Internal bar code: | AACCTCACATGGAATCGAAGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 438 |
| LEAP-Seq percent confirming: | 99.8205 |
| LEAP-Seq n confirming: | 556 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GATAAACCCGCACGATGTCT |
| Suggested primer 2: | ACCTCAAGGTCATTCGCAAC |