| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.178854 |
| Chromosome: | chromosome 4 |
| Location: | 323147 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g217907 | FAP79 | Protein of unknown function | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGAAGATGGCACTGGCTTGCACTCTTGCC |
| Internal bar code: | ATGATCCTCAAGTTGCGAGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 919 |
| LEAP-Seq percent confirming: | 99.8549 |
| LEAP-Seq n confirming: | 3440 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCAACTCCTTCACCCTGTG |
| Suggested primer 2: | CTGTTGGAGAGGGGAGAGTG |