| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.178881 |
| Chromosome: | chromosome 12 |
| Location: | 7011943 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g559800 | GST10 | Glutathione S-transferase; (1 of 1) PTHR10250:SF17 - MICROSOMAL GLUTATHIONE S-TRANSFERASE 3 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGCTGGAGAACCAGCCCATCTTCCTGGCG |
| Internal bar code: | CGCGTCGGCCTTCTCACTTCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 722 |
| LEAP-Seq percent confirming: | 91.7314 |
| LEAP-Seq n confirming: | 2008 |
| LEAP-Seq n nonconfirming: | 181 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACAGTCACCACGGCATGAT |
| Suggested primer 2: | CACAAGCCACACAGTACGCT |