| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.178916 |
| Chromosome: | chromosome 16 |
| Location: | 2063289 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g657300 | CPI1 | Cyclopropyl isomerase-like protein; (1 of 1) 5.5.1.9 - Cycloeucalenol cycloisomerase / Cycloeucalenol--obtusifoliol isomerase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGCAACTGGTGGCGTTGCCACAGCTGCTT |
| Internal bar code: | TGCAGCGTGCTCCATATTTAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 647 |
| LEAP-Seq percent confirming: | 99.5569 |
| LEAP-Seq n confirming: | 3595 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCGGGCATACAGGAAAGTG |
| Suggested primer 2: | TGTAGATGAAGAGCATGGCG |