| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.178971 |
| Chromosome: | chromosome 3 |
| Location: | 5495631 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g185650 | CaM-IP4,FAP251 | (1 of 1) PTHR13720//PTHR13720:SF13 - WD-40 REPEAT PROTEIN // WD REPEAT-CONTAINING PROTEIN 66; Flagellar Associated Protein 251 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCACCACTCGCCCGTCGCCGCCCACTGCG |
| Internal bar code: | GGTGGTCAGTCGGGGGGAACCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 754 |
| LEAP-Seq percent confirming: | 83.2474 |
| LEAP-Seq n confirming: | 323 |
| LEAP-Seq n nonconfirming: | 65 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTCCCAACCTAGTTTTCCC |
| Suggested primer 2: | CTCCTTCGAGGAGTACGACG |