| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.178986 |
| Chromosome: | chromosome 6 |
| Location: | 2696989 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g270400 | GT90-6,GT90F6 | GT90 family protein 6; (1 of 52) PF05686 - Glycosyl transferase family 90 (Glyco_transf_90) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACACTCGCGCTGTACACACTTGCCTCTGC |
| Internal bar code: | CTCTGTTTGTGCGGTGAAAGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1009 |
| LEAP-Seq percent confirming: | 87.1389 |
| LEAP-Seq n confirming: | 1267 |
| LEAP-Seq n nonconfirming: | 187 |
| LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCACTGTCTCGCCAACTGAC |
| Suggested primer 2: | AGGTCTGTCAGGTGGTGGTC |