| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.179073 |
| Chromosome: | chromosome 8 |
| Location: | 346754 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g358570 | MCP23 | (1 of 22) IPR018108//IPR023395 - Mitochondrial substrate/solute carrier // Mitochondrial carrier domain; Mitochondrial substrate carrier protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGCCCCACGGCTTGCGCATTCTTTATTCC |
| Internal bar code: | GGCTATTATTTAGGTTTCCGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 675 |
| LEAP-Seq percent confirming: | 97.7143 |
| LEAP-Seq n confirming: | 513 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCCAGACTTGGCACTACAT |
| Suggested primer 2: | CTTCTCCACTCCAACTTGCC |