Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.179086 |
Chromosome: | chromosome 10 |
Location: | 624926 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g421950 | TEF26 | (1 of 4) PF12576 - Protein of unknown function (DUF3754) (DUF3754); Predicted protein | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGTAGTAGGATCGTCGGTAAAAGACACAT |
Internal bar code: | CAGTTCTGGAGTGCCCGGCGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 547 |
LEAP-Seq percent confirming: | 80.7018 |
LEAP-Seq n confirming: | 92 |
LEAP-Seq n nonconfirming: | 22 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGCCTTACCACTGTCCCAT |
Suggested primer 2: | CATCAACCGCCACAACATAG |