| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.179186 |
| Chromosome: | chromosome 3 |
| Location: | 7359587 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g206350 | OPR19 | OctotricoPeptide Repeat protein 19; (1 of 3) PF06743 - FAST kinase-like protein, subdomain 1 (FAST_1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGGCTCAAATAAGCTACTGGCTCTTGGC |
| Internal bar code: | GTGTACGTTGGGTGACCATAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 437 |
| LEAP-Seq percent confirming: | 99.6766 |
| LEAP-Seq n confirming: | 3082 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCACTTGTCCACAGCGCTAC |
| Suggested primer 2: | GAACAGCATGGCAGCAAGTA |