Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.179313 |
Chromosome: | chromosome 13 |
Location: | 4915783 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g606000 | EFG7 | (1 of 1) PTHR23115//PTHR23115:SF14 - TRANSLATION FACTOR // ELONGATION FACTOR FAMILY PROTEIN; Putative organellar translation elongation factor EFG/EF2 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCAGACGCCAGCAAAGCGACACGTGACGC |
Internal bar code: | GTTAGCAAGTGAGGGGAGCCGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 574 |
LEAP-Seq percent confirming: | 99.8532 |
LEAP-Seq n confirming: | 680 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AATTACCAACAGCTGGCACC |
Suggested primer 2: | GGCTCAACTCTCACTCCCTG |