Insertion junction: LMJ.RY0402.179315_1


Insertion cassette:CIB1
Side of cassette:3'
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre07.g322550 FAP240 Flagellar Associated Protein antisense 5'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):GCGCCTGTACGTATAATACGGTCCGACTTA

Confirmation - LEAP-Seq

LEAP-Seq distance:1011
LEAP-Seq percent confirming:94.7034
LEAP-Seq n confirming:447
LEAP-Seq n nonconfirming:25
LEAP-Seq n unique pos:6

Suggested primers for confirmation by PCR