Insertion junction: LMJ.RY0402.179315_2

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:-
Strain:LMJ.RY0402.179315
Chromosome:chromosome_7
Location:1371721
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre07.g322550 FAP240 Flagellar Associated Protein antisense 5'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):TTCGAAGCAGAGAAGGGCTTACTGCAGGCC
Internal bar code:CGTTAAAAATACGTTACACTAA

Confirmation - LEAP-Seq

LEAP-Seq distance:437
LEAP-Seq percent confirming:100.0
LEAP-Seq n confirming:276
LEAP-Seq n nonconfirming:0
LEAP-Seq n unique pos:1

Suggested primers for confirmation by PCR

Suggested primer 1:CCAGATGAGTGTCACCGCTA
Suggested primer 2:ACCTTCCAGACCAACGTGTC