| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.179394 |
| Chromosome: | chromosome 7 |
| Location: | 1464215 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g323450 | SMM24 | S-adenosyl-L-methionine-dependent methyltransferase; (1 of 1) 2.1.1.287 - 25S rRNA (adenine(645)-N(1))-methyltransferase / 25S rRNA m(1)A(645) methyltransferase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGATTGCCTCCGCTCCGGGTGTGGTGGCGT |
| Internal bar code: | TATGGGTCAGTTGGTATGATAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 303 |
| LEAP-Seq percent confirming: | 89.3903 |
| LEAP-Seq n confirming: | 1862 |
| LEAP-Seq n nonconfirming: | 221 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGAGGGACTGGAGAATTTG |
| Suggested primer 2: | CAGAACCAAGCTACCGCTTC |