Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.179422 |
Chromosome: | chromosome 9 |
Location: | 546920 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g403850 | (1 of 30) PTHR24349:SF79 - NITROGEN NETWORK KINASE 1 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATAGCATAATCGGTGGTTGTACGATTGTGC |
Internal bar code: | GCATGGAGGGGGGCTCCCCCCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 960 |
LEAP-Seq percent confirming: | 96.6601 |
LEAP-Seq n confirming: | 984 |
LEAP-Seq n nonconfirming: | 34 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGGTTTCTCAGTGATTCCGA |
Suggested primer 2: | TGCAGTCACCCTTGACTCTG |