Insertion junction: LMJ.RY0402.179520_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.179520
Chromosome:chromosome_10
Location:1656365
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre10.g429750 antisense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):GTTACAGTACCCGCGTGTCATGAATAGAAC
Internal bar code:GGATAACGCCAGGGGGAACGGA

Confirmation - LEAP-Seq

LEAP-Seq distance:657
LEAP-Seq percent confirming:99.4604
LEAP-Seq n confirming:1106
LEAP-Seq n nonconfirming:6
LEAP-Seq n unique pos:9

Suggested primers for confirmation by PCR

Suggested primer 1:GCTACTGCCATTGTTGCTGA
Suggested primer 2:CATTTATGTCGTGGGCAGTG