| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.179528 |
| Chromosome: | chromosome 8 |
| Location: | 4880259 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g384864 | (1 of 1) PF00018//PF14604 - SH3 domain (SH3_1) // Variant SH3 domain (SH3_9) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGGTTGTGGCCGTGGCTGTTGTTGTTTGG |
| Internal bar code: | CGGCCAGGTAAGGTTCACGTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 41 |
| LEAP-Seq percent confirming: | 98.8806 |
| LEAP-Seq n confirming: | 265 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAATCCCGCCCACTAAGTA |
| Suggested primer 2: | TGTGTTTGTGTGGGTGTGTG |