Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.179565 |
Chromosome: | chromosome 13 |
Location: | 1860857 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g575500 | (1 of 726) IPR011009 - Protein kinase-like domain | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTGAGCAAGCGCGTCGCACCCGGCGCCTA |
Internal bar code: | TAGAACCCCGGCCGTGTGGCGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 196 |
LEAP-Seq percent confirming: | 99.7741 |
LEAP-Seq n confirming: | 3975 |
LEAP-Seq n nonconfirming: | 9 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CACCACACCTCAAGACAACG |
Suggested primer 2: | GGGGAGAGAGGTAGGCATTC |