| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.179570 |
| Chromosome: | chromosome 6 |
| Location: | 8847654 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g310601 | TNP19 | putative transposase; (1 of 781) IPR000104 - Antifreeze protein, type I | CDS|outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGCGTGACGACGATGACGTGCGGGGGGGT |
| Internal bar code: | AGAGAATCGTGTTGCGGTGGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 186 |
| LEAP-Seq percent confirming: | 30.9426 |
| LEAP-Seq n confirming: | 3253 |
| LEAP-Seq n nonconfirming: | 7260 |
| LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTACTCGTCCTCCACGATT |
| Suggested primer 2: | ACAATCACACGACCACAGGA |