| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.179578 |
| Chromosome: | chromosome 2 |
| Location: | 2704315 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g093550 | CYG44 | (1 of 1) IPR000014//IPR001054//IPR029787 - PAS domain // Adenylyl cyclase class-3/4/guanylyl cyclase // Nucleotide cyclase; Adenylate/guanylate cyclase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGTCGTCGTCGGCTCCGCCACCGGTGCCC |
| Internal bar code: | GGATATGCGCCCCACGTCAGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 636 |
| LEAP-Seq percent confirming: | 97.2603 |
| LEAP-Seq n confirming: | 639 |
| LEAP-Seq n nonconfirming: | 18 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGAGAGCAGAAGGGTCAGTG |
| Suggested primer 2: | AAAGCACTAGCAGCATCGGT |