| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.179634 |
| Chromosome: | chromosome 9 |
| Location: | 3747227 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g391282 | XYT1 | (1 of 1) K03714 - glycoprotein 2-beta-D-xylosyltransferase (E2.4.2.38); Xylosyl transferase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGCCGGAAAGGAGGGGAGGCGAAGAGGAG |
| Internal bar code: | TCCTGCGGTAGGTTGAGCCGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 535 |
| LEAP-Seq percent confirming: | 97.6331 |
| LEAP-Seq n confirming: | 330 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCATTTAAATCGCGTCCAG |
| Suggested primer 2: | GGTGCCCGTGTACTTTGAGT |