| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.179640 |
| Chromosome: | chromosome 2 |
| Location: | 5571379 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g108800 | TPR10,DNJ26 | (1 of 1) IPR001623//IPR019734 - DnaJ domain // Tetratricopeptide repeat; Tetratricopeptide-repeat protein 10 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTAGGGCGTACCGGAATTCCCTTGCGCAC |
| Internal bar code: | TAGATGAATTTCTGTTTTGAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 36 |
| LEAP-Seq percent confirming: | 99.0 |
| LEAP-Seq n confirming: | 99 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCTACGACCCGTCGTCCTAC |
| Suggested primer 2: | AACACATTGCTGTCCCACAA |