Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.179640 |
Chromosome: | chromosome 2 |
Location: | 5571383 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g108800 | TPR10,DNJ26 | (1 of 1) IPR001623//IPR019734 - DnaJ domain // Tetratricopeptide repeat; Tetratricopeptide-repeat protein 10 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGCGTGGGAAGCGCTCCTACTGGCTTCCA |
Internal bar code: | CTGGGGCTCGGCGAGGTCTGTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 935 |
LEAP-Seq percent confirming: | 99.6413 |
LEAP-Seq n confirming: | 2778 |
LEAP-Seq n nonconfirming: | 10 |
LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCTACGACCCGTCGTCCTAC |
Suggested primer 2: | AACACATTGCTGTCCCACAA |