| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.179695 |
| Chromosome: | chromosome 10 |
| Location: | 136144 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g418700 | DMA4 | (1 of 1) PF10237 - Probable N6-adenine methyltransferase (N6-adenineMlase); Putative DNA methylase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCTCGAGGGCAAAGGCCTGAAGCCTGAAG |
| Internal bar code: | GTCGCCGGTCGGGATTGCCGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 967 |
| LEAP-Seq percent confirming: | 69.3316 |
| LEAP-Seq n confirming: | 529 |
| LEAP-Seq n nonconfirming: | 234 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCGGCAGCTTGTACTGTTTG |
| Suggested primer 2: | GATGCAATGGTTGGGGATAC |