| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.179729 |
| Chromosome: | chromosome 11 |
| Location: | 1133851 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467681 | (1 of 6) PF00787 - PX domain (PX) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGGTCCAGCTCAACCACTGAAACCGAATC |
| Internal bar code: | GGCGACCGGACACGTGTGTATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 106 |
| LEAP-Seq percent confirming: | 99.904 |
| LEAP-Seq n confirming: | 3123 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCATTTCAAAGCTGGGTTGT |
| Suggested primer 2: | CTTTAAAACCTGCCTCAGCG |