Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.179748 |
Chromosome: | chromosome 13 |
Location: | 3452261 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g587550 | FXL3 | FixL-like PAS domain protein; (1 of 12) 2.7.13.3 - Histidine kinase / Protein kinase (histidine) | intron |
Insertion site details | |
Flanking sequence (orientation from cassette outwards): | CTTAATTGTATCCGGGCATGCAGGTTTGCC |
Internal bar code: | TCATAGACATCGGTAGGCAGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 668 |
LEAP-Seq percent confirming: | 99.3524 |
LEAP-Seq n confirming: | 9819 |
LEAP-Seq n nonconfirming: | 64 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TACCACGTGGCCTCCTAAAC |
Suggested primer 2: | TTCCAATGTGAGCTCTGACG |