Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.179859 |
Chromosome: | chromosome 13 |
Location: | 3906934 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g590550 | COA5,COAD1 | (1 of 1) 2.7.7.3 - Pantetheine-phosphate adenylyltransferase / PPAT; Pantetheine-phosphate adenylyltransferase, CoA biosynthesis | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCTCCCCGCTCACTGCAGCCACGCACCTT |
Internal bar code: | ACTGGTGGCCGGGACCGTGTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 234 |
LEAP-Seq percent confirming: | 99.6364 |
LEAP-Seq n confirming: | 3288 |
LEAP-Seq n nonconfirming: | 12 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAGTGGGTAAGCAGTGGGAG |
Suggested primer 2: | GCTGTGCATGTGACTGTGTG |