Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.179950 |
Chromosome: | chromosome 3 |
Location: | 7663518 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g204050 | ELG6 | Exostosin-like glycosyltransferase 6; (1 of 34) 2.4.2.41 - Xylogalacturonan beta-1,3-xylosyltransferase / Xylogalacturonan xylosyltransferase | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCATGTGCACACCGTCAATCACCACGACC |
Internal bar code: | GTGGGTGCAGACGTACGTTTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 425 |
LEAP-Seq percent confirming: | 99.5827 |
LEAP-Seq n confirming: | 11693 |
LEAP-Seq n nonconfirming: | 49 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATGTAAGGGGACTGTGCCTG |
Suggested primer 2: | AGGCATAAACAGCCCAACAC |