| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.180002 |
| Chromosome: | chromosome 4 |
| Location: | 515708 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g217935 | (1 of 1) K11886 - proteasome component ECM29 (ECM29) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACAGCACCAGCTTGAGGCCGTACGACAGGA |
| Internal bar code: | CTGCATTCTGGTATCGCCATTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 98 |
| LEAP-Seq percent confirming: | 97.1204 |
| LEAP-Seq n confirming: | 371 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGTCGTGTCGTCCTTGTCA |
| Suggested primer 2: | GTGGCGCATACCGTATTTCT |