Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.180104 |
Chromosome: | chromosome 13 |
Location: | 3119244 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g584901 | MKS3,TMEM67 | Transmembrane protein 67; (1 of 1) K19348 - meckelin (TMEM67, MKS3) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTCCTGACTCTCGTGGGACTGATCCGCCC |
Internal bar code: | GGTAGATTACCCGGATGAGCAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 394 |
LEAP-Seq percent confirming: | 99.4816 |
LEAP-Seq n confirming: | 6716 |
LEAP-Seq n nonconfirming: | 35 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGCTACTGCCACTGCTACTG |
Suggested primer 2: | TGCACCTACCTACCCACACA |