| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.180117 |
| Chromosome: | chromosome 17 |
| Location: | 6208125 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g741950 | BBS1 | Bardet-Biedl syndrome-1 associated protein; (1 of 1) K16746 - Bardet-Biedl syndrome 1 protein (BBS1) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTCGCTGTCGCTGAACATTGCTGGTCTGG |
| Internal bar code: | GATTTTAGCCGCCAGGCTAAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 533 |
| LEAP-Seq percent confirming: | 99.5887 |
| LEAP-Seq n confirming: | 10654 |
| LEAP-Seq n nonconfirming: | 44 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACCAGGTGATCGTTGTCAC |
| Suggested primer 2: | GTCGTTTTGTCCCACTCGAT |