| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.180170 |
| Chromosome: | chromosome 16 |
| Location: | 1146214 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g650250 | HFO39,HFO25 | (1 of 33) K11254 - histone H4 (H4); Histone H4 | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTTCACTCCCAGAATCTGAGCTTCCGGCA |
| Internal bar code: | CCGTGCTAGGGCCAAAGACCCAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1029 |
| LEAP-Seq percent confirming: | 80.1467 |
| LEAP-Seq n confirming: | 1530 |
| LEAP-Seq n nonconfirming: | 379 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAAGTCCTGAGCAATCTCGC |
| Suggested primer 2: | CCGATGACAGGTACGAAGGT |