| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.180201 |
| Chromosome: | chromosome 17 |
| Location: | 5831897 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g739650 | MAE1,MFT1 | MATE efflux family protein; (1 of 5) PTHR11206//PTHR11206:SF94 - MULTIDRUG RESISTANCE PROTEIN // DNA-DAMAGE-INDUCIBLE PROTEIN F | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTTGATCGTACATCAATCCGTAATGACGT |
| Internal bar code: | GTACAAGAGTCAAACACCTTGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 135 |
| LEAP-Seq percent confirming: | 99.7955 |
| LEAP-Seq n confirming: | 1952 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCACGTGTGTTCATTCGGT |
| Suggested primer 2: | ATGGGTGTCGCTAACCTTTG |