| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.180212 |
| Chromosome: | chromosome 14 |
| Location: | 3079421 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g628600 | CYA13 | Putative adenylate cyclase; (1 of 22) PTHR11017//PTHR11017:SF145 - LEUCINE-RICH REPEAT-CONTAINING PROTEIN // SUBFAMILY NOT NAMED | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTATCATACGGGCCCCATCCGTCCATCAT |
| Internal bar code: | ACGCAGCTCTCAGACCCCCGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 730 |
| LEAP-Seq percent confirming: | 87.9733 |
| LEAP-Seq n confirming: | 790 |
| LEAP-Seq n nonconfirming: | 108 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGTGACATTCCTGGTAGCC |
| Suggested primer 2: | ATGGTAGTGTTGGTCAGGGC |